Comments for Skunk Anansie, Stoosh

there''s a ghost track:run the first track, then rewind... the ghost track lasts approximately 2 minutes 30 s.

nice birthday present for your grandmother!

it's amazing, thank you!

ingné

Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp

Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS

Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology

MTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTS

Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition v v v Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition v Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition v Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition vMetasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition v Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition v Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition

igné

"les pingouins ne volent pas"

"les pingouins n'aiment pas Thomas"

Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:Your e-mail address: Your comments for Stoosh:v

GG is still HERE !!! February 1st, 2007 Ohhhhhhhhhh yeahhhhhhhhhhhhhh

Thais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais OliveiraThais Oliveirav

Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira Thais OliveiraThais OliveiraThais OliveiraThais Oliveira Thais Oliveira Thais Oliveira Thais Oliveira

Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology MTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTS

>at3g55020_genomik_6403pb GTCACACATGTAATAAACCTTGGTCGACAATCTCGCCCTTTCCATGTGAT TTCTCCACTTCCTCTCTCTCTCTACTGCAACTTCCTCCTCCTGCTTCAAC TTCATTCGGGTAATGATGAACTAGCGTAGAGATTTGGATCTTCTTCTTCG TCCTCTCACCAACTCTTCACCGGTTAGATCTCTTTTTCACGCTAACGAAT GAGGAGCGTTGCCGCCGCCGCCGCTGCTGCTGCTGCTGCTTCTAAGCCTT CTAATCCTCTCGTCGCCTTTGAGCACAAGAGGTTTCGCGTTTTTCCCCCT TTCCCCTGTACATTTCTGCTTCCTCTTTTTTGGTTTGAACTTGCGCTTCT TCTCTCTTTAGCTTTTTGCTAGACTCGCTGAGCGAAATGTTGTATCTCCG ATTACGAGAGTTTTAATCCGTCTTGTTGTTAGCGTAATTTTGCATTTTCT TAACAATTTAGTTGGGATTTTGATGATTATTGGTCTTGATTTGAAGTACA TCCTAGTGATTTGGATTTGAATGCTGATTTTTGTCCAGTGGTGACTATTG TTCTCAATGTGGCATAATCGTTAGTGAAGGTAGTCTTTGATAGCAAATTC GAGTTGTTTCTGTTGTTCAATTTCTTGAAAACAAACTGATGAGAGATGCA ATTTTGTCATTGGATATAGTAAGGTTTCGTCTGAGCTCTGGATGGGCTTT TAATATATCGTGGGAACTCATATCGCCTTTTTTCTTTGTCAACAGGGATG CATACGGATTTCCTGTCAGACCTCAACATGTGCAGAGATACAGAGAATAT GCTGATATTTACAAGGTTCTTTATCCATAAATCTCACTTTTTCTACTCAG ATTTTTCATCCGCATGATTCATTGGAACAGCTTGATTTCCCTCTAATTTG GTTATGACCGTTGTGATATTGTGAGAATCCTGATTCCATTTAGAATCGTA GTCATAGGGAAATCCTGTGTGAAAGATATCAAAACTAGACTAAACTATAG CTTATAATAAGTTCTTTTTGGTTCTTGGAATGGTAGAAATTGATCCCATC ATTATTTCCTGATTAAGTCCCTAAACTTGTGATGTCACTCTTTGCTTTCA ATTAGGAAGAAGAAGAAGAAAGGTCGGACAGGTGGAGCAGTTTCTTGGAA GATCATGTTGAATCGACTGAGTTACCTACAAACGGATCTTCTGAAAATAT TCACGCACCGTTTAGTGAAAGTGAGAAGGAAAAAGAAAAAGAATTAAACA AGGGGCCTGGTGAAGATCTGCATACTGACAAGTTAGGTTCTGATGTAACT CCTGATAATGCCAGTGAAGAAGAAGGACACCCCGATGCAGAGAAGAATGT TCACAGAGTGCAATTATGGACTGAGATCAGACCGTCTTTACGATCAATTG AAGACTTGATGAGCATCCGTGTCAAGAAGAAGGGGGATTTATCAAAAAGC GAGCAAGAGGCTCCGAAGGTGAAGATTTCACCTTCATTTGATGATGCCAA ATCTTCCAAGGGAGCATCTGATATTGATTCTGAAGACGAGTTCTATGATG TTGAGAGGTCCGATGTTCAGGATGGTTCTTCTTCAGATGGTACAGGTGTC TCTGGTATCCCTGTTGCTGCTGATGCAAGTCCACTGTCTACATGTCCTTG GAAGGAAGAACTTGAAGTGCTGATTCGCGGCGGTGTACCTATGGCTCTGA GGGGAGAGGTAATAAATCTTCTCATGTTTACATTCCTATGTGATATCATG CTCTAGCTCTCCATACTATAGTTCGTTAGTCTTAGCTCTTGCTCAATTAT AATCGTCACATTTATCAATAACATTTCAGTTATGGCAAGCATTCGTGGGC GTGAGGAAACGACGATGCAAGGATTATTATCAAAACCTTCTTGCAGCAGA TGGTTCTGTAAACACCATAGAGCAAGAGGATATGCAGCATGTTGATGATA AAGGTTCAAGTACAGAATCTATTGCTGTTGTGGAAAAATGGAAAGGACAG ATAGAAAAGGTAGTACTCAAAATTTATTCAGCCTTGACCCTCTCTATGTA GTGATGCAGCGTGGCTTATGCTGAAGTTGATCAGGATTCTTATGCCGTTG CTTGTTTAAAGTACAGGACTTACCTCGGACATTTCCTGGTCATCCTGCTC TAGATGATGATGGTAGAAATGCTCTACGGCGTTTGCTTACTGCTTATGCT AGGCATAATCCTTCTGTAGGATACTGTCAGGTATTTGTTCTTAACCAATA TCATGATCTTTATTGTAGTACCTCTATTTTAGTACCGAGACATAGTAAAT TAACATTAATATCAAGTTAATATCTTTTGTCAATATACTTTCTGCAGGCT ATGAATTTCTTTGCTGCGCTTTTATTGCTTTTGATGCCAGAAGAAAATGC CTTTTGGTATGTTCACAAATTTGATGAATTTATCATCTCCAAGTCCTAAT ATTATTTCCTGTGAAAATCGAACTCTTTTGATCTGTGTTTACTGTTTAGT TTGTGTTATATCGCCTTCCTTCTTCCAAACATTAACTGTTCTTGGGTCAT TCTCTGTATCCTTATTTCTAATTTAACCAATGTTGTTTGATTAATCTACT TTTTTCATTCCTAATCTTATTTTTCTGTCTAAACATGAACTCCTTGCTCT GTGTTTAGTTTTAATATCTATCACTTTCATATTCTCATGGTTGATCAAAC TGTTATTAAGCATCCTTATATCTTCTCCTTTTTTCTTTCTAAACTGATGC CCCTTCTAATTAAATACTTGTGATTTTTAGGGCACTGATAGGACTCATTG ATGACTACTTCAATGGTTATTATTCAGAAGAAATGATAGAGTCTCAGGTG ATAATATTAGTTGCCTTTCTATACATTTGCAAAAATTTTGGGCTGACTGG TGATAGCATCATGACAACATGTACCTTCATATTTTAGGTTGATCAACTAG TTCTGGAGGAGTTAGTTCGAGAAAGATTTCCTAAATTGGGTGAGTTCCCT CAAAGTTTTTTGTTTCATCTTGTAGAATGTTCACAGTTAGTACTAAGCTC TGCAACTTTTCTATGTCTACAGTTCATCATCTGGATTATCTTGGAGTGCA AGTGGCTTGGGTTACAGGGCCATGGTTTCTTTCCATCTTCATGAATATGC TTCCATGGGAAAGTGGTCAGGTTTTAAACATTGGAATTAAAGCTGTCTTG TTTGAAATAGAATTGAGTAACTAGTAAATTATGCTGGCAATCTGTTAAAA TTTGATCATCTTTCTCTTTGAGATTTGGGACTGAGAACCCATTTTCTTTC TAAATGTTCGTCTTCTTGATCACAGTTCTTAGAGTCTGGGATGTGCTTCT CTTTGAAGGAACTCGTGTTATGCTTTTCAGAACAGCACTCGCATTGATGG AACTATATGGTACTTGATTGAAACTGCTGGTCTTTCAATTTAAGTGAGAT GGTTTGTGGACCTTCTGAACGCAGTGGCGTCATCATCGAGACTGCTCTAA CTTATGGTTTAATTCACTTCAGGTCCTGCATTAGTTACTACGAAGGATGC TGGAGACGCTGTTACTTTGCTACAATCACTGACTGGATCAACATTTGATA GCAGCCAGCTAGTTTTAACTGCTTGCATGGGTTACCAAAATGTACATGAA ATTAGATTGCAAGAATTGCGAAGCAAGCATAGGCCAGCTGTGATCGCTGC ACTTGAGGAAAGGTCAAAGGGGCTTCAAGCGTGGAGAGATTCTAAGGGAC TTGCCTCCAAATTATATAATTTTAAGCAAGACCCAAAATCTGTTTTGGTG GATAGCAAAGCCTCATTGTCAAATGGGAGTTTGTCTCGATCTGAGTCAGG ATCAAGTAATGCAGATGAAGTGTTGGTTAGCCTAACTGGGGATGGGGAGG TAGATTCTGTTCAAGATCTTCAAGCGCAGGTAATTTTTGTCCTTCTTGTT GGCTTGAAGATACTCCTCTACGCCCTTAGTACGCTTGAATGGTGGATGAT TATGTCTGGTGAACGGTAGAAAAAATCACTTGATACCTACAGTCATGAAA CCCCCTCTGAAAGTTGACTGACAACTTTTTCAGGTTCTGTGGTTGAAGGC TGAACTCTGCAAGTTGCTTGAGGAGAAACGATCAGCTCTACTTAGGTTAG TTTCTTTTCTCAACCTAAAACTGGCACTAAATGGTAGAAGTTTTATATCT TTCCTTATCATACCTCAATATGTAATGTCTCCCAAACTTCTGATTTTGTG GTAGAGCTGAAGAATTGGAGATTGCTCTCATGGAGATAGTAAAGGAAGAC AATCGGCGTCAATTGAGTGCCAAGGTATTCCAATGAAGCTTGCCACTTGA CAGTTAATTTTCCAAATAAGCCTATAAGCTCGCATTATGTTACTTGTCTC TTTATTTATGTTCTGAATACGAAGACTATTTTCTATGTCACTTTTACCAT CATTACTTTCCTTTCTCTCTCTTTTCTTCTCCTGCTGGTTCCTCGTCACG CATCTCTGTGCTGATCCAATTTGAAGGCTCATTGGTGCTAAGTTAGTTTT GAGATAGTCTTGAGATGTGAAATGCTACTTGTCATGAATGTGAACTTCAG GTCGAACAGTTAGAGCAAGAAATGGCCGAAGTTCAGAGACTCCTCTCTGA TAAGCAGGAACAAGAAGGTGCAATGCTACAGGTTTGCATATGCATGATCA ATCTGTTCTTCTTCTTTTTTCGTTTGTGACTGAGAAAGATTCTGAGATTA ATTGATATGTATGAAGGTCTTGATGCGGGTGGAGCAAGAACAGAAGGTAA CAGAAGATGCACGAATATTTGCTGAGCAGGATGCAGAAGCGCAGAGATAT GCTGCTCAAGTCTTGCAGGTAAAAAGTTTGATCTGACTCCTAACACAGAT GTGGCTAGGCTATTAAGTTTAAAAGAGCTTTAACTGCCTCTTGTTATAGG TCGTTACTCGCCTTCCATGGAGTAGAGTTACACATTAGTTTAGGACCATA ATCTCTGTAAATCCTGTATTAACCCTTGTCTGTATTTCAGAGCTGCGTGA TTTGAATGCAACTTTATATCCTTTTCCTTTTTTTGTATTCTCCTGTTCTA TCTTAGATCGTTTCTGTAACGAATATGATAACTGGTCTAGGAAAAATACG AGGAAGCTGTTGCTGCACTGGCTGAAATGGAGAAGAGAGCAGTGATGGCA GAGTCCATGCTCGAGGCAACTTTGCAGTATCAATCTGGCCAACTCAAAGC ACAACCTTCACCACGGTGTGTTCTTTTTACCTGAGTCAACTCAAAACATA AATTGTGTACACAACTATAAACACTCAATTGGGTTATGACTAATGACCCA CCCTTGTGTATTCTGAATTGGGTATATATATACATATTTTTTTAACCTTC CAGGCAAGTTAACCAAGATTCGTCACCAGAACCTCCTCCAAGCAGGATCA GTTTGCTAGCACGGCCATTTGGACTAGGGTGGCGCGACAAGAACAAGGTA AATCTTCTTCTTACACAAAACATATATAGAGACGGCTTCACCCAAGAAAC ACCTCAAAATTGTCTTTAAAACCAAATAGTTTCTCCTAGTTATGTATACA AACTGACCCGCAATTTGCAGAACACAACACCTGAAAAATCTCCGGAGCAT GTTAATGACGAGAAGCAATCATCAACAGAGGCAAAAGAGACTAACTCTGA ACCAACGGAAACTAAGGTCCAAGACATTTCCTAGGTATAATCAACCTTGA AGCTCTCTTTTCCACTTCCATCTTCAAATCGTAGTAGCTAAATCGTCCTA CGTGTAGTCTCAATAGCTTCTCAGTTCTCTCAGTCACCCTTTTTTCATAA TTCCGGATTGAATTTTGGGAGAACTTTTAAATACATTCATTTGTTTGTTT GTGGTATGCTGCTATAAATATATTCATTTTAAGGTGATGGGATACATACA AGACATAAATGGTGTATATAGTTCATTAATCTCTAAGCTAGTAAGTAAAT GATTCTCTTGGATACCCTCAGTTTTATAATATATGAATTTTAT

lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph l j j j

sss

lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph

lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph

lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph

Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic

Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic

Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic

there''s a ghost track:run the first track, then rewind... the ghost track lasts approximately 2 minutes 30 s. nice birthday present for your grandmother! it's amazing, thank you! ingné refreshyourpage@idiot.com Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology MTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSMTSM

Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic

The mind could be a jail

Yeah oh YEAH !!!

vive moi

so close to me of Cure, yeah !!! How do you do my friend, isn't it ? Me too Miaou Sae tu es sexy dans ton bikini

fsdggdgrett

ddfdfs

Search for: ArtistAlbumSong Home News Artists Searching Database Statistics

Search for: ArtistAlbumSong Home News Artists Searching Database Statistics

Search for: ArtistAlbumSong Home News Artists Searching Database Statistics

Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics

Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics

Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics Search for: ArtistAlbumSong Home News Artists Searching Database Statistics

Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.

Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.Par défaut et sauf contre temps, vos résultats vous parviendrons sous 48 à 72 heures ouvrées maximum par e-mail non crypté Nous vous rappelons que les options de livraison proposées par GENOME express (e-mail crypté, format .ab1, ect...) doivent etre précisées sur la feuille de production. Cordialement.

Killer_GG is the greatest Unreal Tournament player !!!

control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic there''s a ghost track:run the first track, then rewind... the ghost track lasts approximately 2 minutes 30 s. nice birthday present for your grandmother! it's amazing, thank you! ingné refreshyourpage@idiot.com Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybern

control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic there''s a ghost track:run the first track, then rewind... the ghost track lasts approximately 2 minutes 30 s. nice birthday present for your grandmother! it's amazing, thank you! ingné refreshyourpage@idiot.com Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybern

control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic there''s a ghost track:run the first track, then rewind... the ghost track lasts approximately 2 minutes 30 s. nice birthday present for your grandmother! it's amazing, thank you! ingné refreshyourpage@idiot.com Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybern

control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic there''s a ghost track:run the first track, then rewind... the ghost track lasts approximately 2 minutes 30 s. nice birthday present for your grandmother! it's amazing, thank you! ingné refreshyourpage@idiot.com Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybern

control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic there''s a ghost track:run the first track, then rewind... the ghost track lasts approximately 2 minutes 30 s. nice birthday present for your grandmother! it's amazing, thank you! ingné refreshyourpage@idiot.com Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybern

control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic there''s a ghost track:run the first track, then rewind... the ghost track lasts approximately 2 minutes 30 s. nice birthday present for your grandmother! it's amazing, thank you! ingné refreshyourpage@idiot.com Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybern

control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph lexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliograph Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic there''s a ghost track:run the first track, then rewind... the ghost track lasts approximately 2 minutes 30 s. nice birthday present for your grandmother! it's amazing, thank you! ingné refreshyourpage@idiot.com Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to comp hfghfgh Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MSTT by the three editors and invited authors was published in a special issue of the journal World Futures entitled "The Quantum of Evolution". MSTT is also being applied to computer science and the foundations of mathematics by Turchin and his colleagues. The bibliography of PCP includes most publications on MSTT. Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybernetics to their own development. Our philosophy too is based on cybernetic principles. Our epistemology understands knowledge as a model, which is constructed by the subject or group, but undergoes selection by the environment. Our metaphysics asserts actions as ontological primitives. On the basis of this ontology, we define the most important concepts and organize them in a semantic network. At a higher level, we also lay out the fundamental principles of cybernetics in terms of these underlying concepts. One of the central concepts is that of evolution in the most general sense, which is produced by the mechanism of variation and selection. Another is control, which we define in a special cybernetic sense, and assert as the basic mode of organization in complex systems. This brings us to the central concept for MSTT, that of the metasystem transition, or the process by which control emerges in evolutionary systems. On this basis we then reconstruct the complete history of evolution, from the Big Bang to the present, as a sequence of MST's. An extrapolation of this sequence provides us with a first glimpse of what the future might bring. Finally, the possible dangers and opportunities of our evolutionary future direct our attention to the need for formulating an ethics, based on evolutionary and systemic principles, that could guide our actions. Background of the theory The concept of the metasystem transition was introduced in Turchin's book The Phenomenon of Science, which was followed by Inertia of Fear and the Scientific Worldview. The basic tenets of MSTT were formulated by Turchin and Joslyn in "The Cybernetic Manifesto". As Heylighen joined the Editorial Board, the work on MSTT intensified, and the Principia Cybernetica Web was created. A major collection of papers on MS Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition Theory (MSTT) is the name we have given our particular cybernetic philosophy. Its most salient concept is, of course, the Metasystem Transition (MST), the evolutionary process by which higher levels of complexity and control are generated. But it also includes our views on philosophical problems, and makes predictions about the possible future of mankind and life. Our goal is to create, on the basis of cybernetic concepts, an integrated philosophical system, or "world view", proposing answers to the most fundamental questions about the world, ourselves, and our ultimate values. Our methodology to build this complete philosophical system is based on a "bootstrapping" principle: the expression of the theory affects its content and meaning, and vice versa. In this way we aim to apply the principles of cybern

!!!BALISE Opération B2Yac Edition 2004 BALISE!!!! Cherche sur cette page une séquence d'ADN génomique. Identifie le code AGI de cette séquence et relève uniquement le nombre à 5 chiffres correspondant, que l'on note "X". Dans le labo, il faut que tu te rendes à la salle numéro [(X-2016)/300]-44.68 (les numéros sont au-dessus des portes) et que tu découvres un autre indice caché derrière l'une des feuilles A4 murales...Bonne chance B2Yac !!!

ÿãÄ šºè
‡ ÿ “
ŸâAÿó3ÿÎùÿüï,ŸÿþÇyÎÿÿÿþº¹ ßÿÿÿkIóŸÿý ÑÊJćÿãÄ:ºô
�P ¬Å/ú*uÿ£õÿô8å4HŸâ0§ñST8ïÿÿÿEdSM¨ˆÿà‹ÿ‚ €ã—Îø%ÿðKøH; ( ÿãÄÂJò
“h
a*P8`Ès4Oü‚‰r!þŠLŠKÿôTµ IRÿÿ­K×gÿÿû;³¤Š’1ßý_þ0§+dƒ›¢2ÿãÄ‚¶ô
‘P dT1:i­:?Óz:üýíÿî�0Ámþ# …6ÿÿÿíµÌ#'ÿ£†ü�ÿÂü
ÞBêJÿãÄ N¼Ô 
ªKÿÿÿÿÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•a* a‚ ‚ßÿÿÿÿÿãÄ R¼T 
ÿÿÿé̘ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r H0% „õ Ó…˜‚p؉2_— ƒÿãÄâºíA“h %ù¡pÒ–—è5ÿñ˜u²Ó¦?›ÿÿv[Óßÿÿð秦¤ Ì
Áý«bH5ü/¦é²ó#eW ¡q�ÿãÄê¶ô
’P
Ré:¯A¨-Ÿýjuÿú�ÿ~{“󱀜wÿÿþŸÿÿlËûf´„/?ÿŸÿá R\Un0•(ÿ3AÿãÄ Bºð
‘h
ÿÐgoÿgdUù�ù�EKZ•/ÿÿ­K×gÿâ§ÿ,îÎ’*HÄ; ßÿ¿þ0§+Ml“€ÓQe‘3ÿãÄZÂä
”8
_ò|Ýfÿîšÿ=Øô3ÿýÐÇ yßÿþc£Ld3ÿÓÿÌiŒæ)äbZÿÿð$q ÀÀ0 ÿãÄ · ‘…€l3‚žÿÿþyßÿÿ[*¡NkùÃÿœÿÿÿõ%I%$æFÁŽòÇÿ,éUZ¿Ë_ÿ-* 
k\ȃÿãÄ zRáA”h
pbî¢hÅ¿Èq 'Kè¢È¢�ÿÑEJ215ÿÿj(è©×ÿÿé$´’tŒ’Pîmÿÿþbb]ãÌ\JÉ‘äÿãÄØ6L ß -™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý Ú- ÿ°0Ð,€Ä ÿãÄ¡&€yV 8€P€ °Õã¨�(MÿÿÿÿÓ[Üô÷}Î!Wxø \ø&¿ÿùG(àB‰%Áú ¡q�RÿãÄ ¶ô
’P é:¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ U Và0ÂTÿãÄ"‚ñA“h
 p*üÍÿ'4ÿÙÙù�EKZ•/ÿþµ/]Ÿÿÿâ¥�ÙÒEI‡oþ¡[ÿã rµÌ\JÉ‘ÿãÄà6L ß ä-™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ �ÿÿÿÿÿÿÿÿÿþ… 0‰^
žÿ­ÿÿÿãÄ k=¸¸¨×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿãÄ" k=¸¸¨ÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿÿãÄ7 k=¸¸¨©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„ºÿãÄL k=¸¸¨ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿãÄa k=¸¸¨ÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰ÿãÄv k=¸¸¨^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º<0…1†f15”0n
x0€Ó0<À•0ÿãÄ‹ k=¸¸¨@_0@, ˆ (h T×‹Õ ãñøü~?ƒŒ€Ù1.ýE_*9pÐrH‰>I N˜“#šd™
&�ˆoþ™»&ÿãÄU"jú¸
›  ûä8ƒHpç�á["h¤UGÿS©ªA”hy#AZˆJ%Ž‘T“1IÑU_ÿt7ßú*Y�M6 Ù*ÿãÄŠ¶üÉ�P 3XÙÇN‚vÿMÙÿÝœåÿú*!ãÁI¿…?‹‡t_ÿÿÿ{<Ó”Ò"ßüððÿ¿þ* ð ÿãÄ"Ká“8 ,ᣆdÕPºÝ¡Wà5 5`ÂÿÆŒy?ÿýGŽÿÿÿÿÿÿÿt?öÿðÉïù ¡q�Ré:ÿãÄ ¶ô
’P ¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ U «pa*PÿãÄ ²‚ñá“h
8~f‚ ÿ�BÑ.D?övE_þD#ÑRÖ�%Kÿÿ­K×gÿÿø©gvt‘RF!Ûÿ¨VÿøÂœ­C�h�rÿãÄ¢ºð
“h }J$UåôÖ›£û¦ôtO{þêjïò!ÿ³©¿ÿÿÿ¡¡M3úœM?ÿ% ÿáå ò[ÿãÄ ’ �“8 ’)ºbI/ý_�!�P±°Á`€ xD“ÿÿùBÿ”;ÿÿÿÿÿÿñþ‚0wÿÕ ¶Àm ÊÀÿãÄ *N®YÕ
ÉP´’(("³šµÿÿI&ROÒI”“õ%R_ÿ·ÿÿÿþ¥þRÕ¼¥©}KRÿy@Y
1…2<0…1†fÿãÄ È6@
_ 15”0n
x0€Ó0<À•0@_0@, ˆ (h T׋Õ"81À´0.pxGøÌ„SüÑÌ ÿãÄ’ÊÈ
•P
?ü�»ÿ�Éãð»à&ÿÿö“¹9îyçÿÿÿ±ç’)ãÆ<¢ßÿÿÿ�A¼¸ü�ÃÕ RDz¨VâÿãÄB¶ð
�h ¶ë1IÿÑI×þ¤ªKÿõ%�ƒr_"ÿ"ýZµÿúõ£Z-1Oþ*ñPPI/þ+üV %ƒ\†�Ó[ÿãÄ ‚Nä
”h $åòâÿæŒ}ôRdR_ÿ¢¥­
ÅKÿýTµ �“ÿÿ÷gII‹ÄÐ5õø]N‹êdƒ›¢2ÿãÄ‚¶ô
‘P dT1:i­:?Óz:üýíÿî�0Ámþ# …6ÿÿÿíµÌ#'ÿ£†ü�ÿÂü
ÞBêJÿãÄ N¼Ô 
ªKÿÿÿÿÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•a* a‚ ‚ßÿÿÿÿÿãÄ R¼T 
ÿÿÿé̘ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r H0% „õ Ó…˜‚p؉2_— ƒÿãÄâºíA“h %ù¡pÒ–—è5ÿñ˜u²Ó¦?›ÿÿv[Óßÿÿð秦¤ Ì
Áý«bH5ü/¦é²ó#eW ¡q�ÿãÄê¶ô
’P
Ré:¯A¨-Ÿýjuÿú�ÿ~{“󱀜wÿÿþŸÿÿlËûf´„/?ÿŸÿá R\Un0•(ÿ3AÿãÄ Bºð
‘h
ÿÐgoÿgdUù�ù�EKZ•/ÿÿ­K×gÿâ§ÿ,îÎ’*HÄ; ßÿ¿þ0§+Ml“€ÓQe‘3ÿãÄZÂä
”8
_ò|Ýfÿîšÿ=Øô3ÿýÐÇ yßÿþc£Ld3ÿÓÿÌiŒæ)äbZÿÿð$q ÀÀ0 ÿãÄ · ‘…€l3‚žÿÿþyßÿÿ[*¡NkùÃÿœÿÿÿõ%I%$æFÁŽòÇÿ,éUZ¿Ë_ÿ-* 
k\ȃÿãÄ zRáA”h
pbî¢hÅ¿Èq 'Kè¢È¢�ÿÑEJ215ÿÿj(è©×ÿÿé$´’tŒ’Pîmÿÿþbb]ãÌ\JÉ‘äÿãÄØ6L ß -™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý Ú- ÿ°0Ð,€Ä ÿãÄ¡&€yV 8€P€ °Õã¨�(MÿÿÿÿÓ[Üô÷}Î!Wxø \ø&¿ÿùG(àB‰%Áú ¡q�RÿãÄ ¶ô
’P é:¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ U
ÞBêJªÿãÄ N¼Ô 
KÿÿÿÿÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•a* a‚ ‚ßÿÿÿÿÿÿãÄ R¼T 
ÿÿé̘ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r H0% „õ ¢«Š)tÁøMeún´Ôd‹ÿãÄB~ñá’h y»›�âN–?í­ÑüˆG¶‚áKZ:H£ÿÛÿ¯^¿þ*~ún©*’y�r…oÿŠÇ>T[ƒ-°ÿãÄb¾ì
“P
|gÌé¡þ›³ÿû³œjþó•ñ›ÿÿèr¢)—oÿÿövgcNR"ßÿÿþR•=
Œ¢=8ÿãÄRRÀÉÔ 
^6Z,¥­ëF´}híëGýÿÿê2"Á @ÂÉÿÿÿÿÿÿÿþ¶Z’&ˆ¸_À i:ÃU
G .˜ÿÿãÄ ŠF%ø¸/$ÿ_ÿýmÿÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸô* :ÌÅ  L oM:�ñA‹Œ®`E Âp¸EÿãÄZN×Q˜ lsÉõAÌÂxÁ“LÀ€�pPn¤ÿýDÀgò/ÿÿÿÿÿÿÿMéôê
�
ä"†• %ƒ\†�Ó[ÿãÄ ‚Nä
”h $åòâÿæŒ}ôRdR_ÿ¢¥­
ÅKÿýTµ �“ÿÿ÷gII‹ÄÐ5õø]N‹êdƒ›¢2ÿãÄ‚¶ô
‘P dT1:i­:?Óz:üýíÿî�0Ámþ# …6ÿÿÿíµÌ#'ÿ£†ü�ÿÂü
ÞBêJÿãÄ N¼Ô 
ªKÿÿÿÿÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•a* a‚ ‚ßÿÿÿÿÿãÄ R¼T 
ÿÿÿé̘ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r H0% „õ Ó…˜‚p؉2_— ƒÿãÄâºíA“h %ù¡pÒ–—è5ÿñ˜u²Ó¦?›ÿÿv[Óßÿÿð秦¤ Ì
Áý«bH5ü/¦é²ó#e?N;3ÿãÄ¸.hÉÞ8‚;0âÓ
0W€À*\à i°Ó^wñ�TxEÿÿÿÿÿÿX*X8 $<0…1†f15”0nÿãÄ È6@
_
x0€Ó0<À•0@_0@, ˆ (h T׋ÕRàÊ\ Â…ÍŠ\�ÿò|éÿ7/›ÿü¾è¨ÓÿãÄ‚ÂÔ
”h ÿüÜÀÑ"@”y·ÿÿš@Ñ$R ÿÿþ‚ã&\Y|xq+ÿÿÿð[!(�`§ÿÿèé¡ Äñ²ÿãÄ zVØÉÑ� ÑE$’KZ(¤—Z(¢—¢Š(úÑEÿÿõ$d0î6ÿÿÿÿÿ¥ÿêI'ô’I'”F`ÑÍ.š¢
G .˜ÿãÄ ŠF%ø¸/$ÿÿ_ÿýmÿÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU Kîà .¢Ì‹M?ÛÇ<ƒ¹�q¥ô‰²ÿãÄêR» T 
úFÁ' È¡8„ÀŠa9ÿÿý9€„€Q0�ŒMÓÿÿÿÿÿÿÿýeôŠ
t Ð*ÐAAØi: ð ÿãÄ"Ká“8 ,ᣆdÕPºÝ¡Wà5 5`ÂÿÆŒy?ÿýGŽÿÿÿÿÿÿÿt?öÿðÉïù ¡q�Ré:ÿãÄ ¶ô
’P ¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ U
ÞBêJªKÿÿãÄ N¼Ô 
ÿÿÿÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•a* a‚ ‚ßÿÿÿÿÿÿÿÿãÄ R¼T 
é̘ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r H0% „õ â«Š)tÁøMeún´Ôd‹yÿãÄÂ~ñá’h D›'Å$,ÑÂ>¿í­ÑüˆG¶‚áKZ:H£ÿÛÿ¯^¿þ*~ún©*’y�r…oÿŠÇ>T[ƒ-°ÿãÄb¾ì
“P
|gÌé¡þ›³ÿû³œjþó•ñ›ÿÿèr¢)—oÿÿövgcNR"ßÿÿþR•py0.ÿãÄòNä
Ñ€
…ÃD4A ‚³ÿÿÿõ­Ý!|G!ÿÿÿÿÿÿÿ ‚}H´ �D<=È å\¿±›<ŒUWÙÿãIJNÜÈÈΙT½™™ŒÌßÆfüã¿GõCŸ4Ñ©ƒRÇqßÿÿÿÿýMoSM5µ4ÓM6& ! >$5<0…1†f15ÿãÄ È6@
_ ”0n
x0€Ó0<À•0@_0@, ˆ (h T׋ª ƒ<7xn ð’h\ÙþO“…Cô7ÿ÷ÿãÄÚÂ| –PRru'ÿÿš?ƒX+$ÿÿñø݉ÉØ÷ÿÿÿèÌ„…ˆ…�NŸÿÿþ<4œn ¿ÿÿæÄõdƒ›¢2dÿãÄ‚¶ô
‘P T1:i­:?Óz:üýíÿî�0Ámþ# …6ÿÿÿíµÌ#'ÿ£†ü�ÿÂü )tÁÜ&ˆÿãÄ bFð¡“h ²Á�éºÓQ’-ï[™"Š¿¶´kGûh >µ£¤Š?öÿëׯÿýôÜ>+RU$ó åø¬såAUC`lI(ÿãĺ¶ð
“h S:*ù‚i¡þ›³ÿîÎ’ÿþô–¥&\#£ò!ÿÔµj»ÿÿvgdRZ&G¿ø©ÿøs©_ø¬ ÿãĪ‚þ�“P ‰Àœ4pX¦ªú¤*ü0
ùu_þßÿüñ‘ßÿÿÿÿÿøyûÙÐ&ÕˆƒïÿˆSßðíW ¡q�ÿãÄê¶ô
’P
Ré:¯A¨-Ÿýjuÿú�ÿ~{“󱀜wÿÿþŸÿÿlËûf´„/?ÿŸÿá R ÌÀ
À ªD[ÿûÿãÄ ºNßÐ� ¢‹^‰«¢‹tQu¢Ýÿÿõ$"C¸Ûÿÿÿÿÿÿÿú&(RLr
q ­
G .˜ÿÿ_ÿýmÿÿÿÿ„`.ÿãÄ ŠF%ø¸/$›ÿþ7ÿÿ„Uw™þŸô* îä +N¯Oo?üóÏ<óïû]ê�S¦:c™ÆZöEki~[2ÉÿãÄ)ÊNç Xh
–l¶è¦Š ×)YZ�¢º
óÃ9ÿûÏÿô0†Hÿÿÿÿÿÿú ¦šo@� ˆ U¬!s"]ÿãÄzRà
”h
Á‹º‰£ÿ21E_è¢È¢�ÿÑEJ215ÿÿj(è©×ÿÿé$´’tŒ’Pîmÿÿþbb]âÌ\JÉ‘ä-™ÿãÄ Ø6L ß „¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý*Š ?œ.ÀÄ€ð
HÿãÄ¡&xQV@
ÂÑÆ8vStÿÿÿÿÓ[Üô÷}Î!Wxø \ø&¿ÿùG(àB‰%Áõ ¡q�Ré:ÿãÄ ¶ô
’P ¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ * «pa*PÿãÄ ²‚ñá“h
8~f‚ ÿ�BÑ.D?övE_þD#ÑRÖ�%Kÿÿ­K×gÿÿø©gvt‘RF!Ûÿ¨VÿøÂœ®Ì\JÉ‘ÿãÄà6L ß ä-™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ �ÿÿÿÿÿÿÿÿÿþŠ 0‰^
žÿ­ÿÿÿãÄ k=¸¸¨×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿãÄ" k=¸¸¨ÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿÿãÄ7 k=¸¸¨©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ÿãÄL k=¸¸¨ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿãÄa k=¸¸¨ÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰ÿãÄv k=¸¸¨^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½<0…1†f15”0n
x0€Ó0<À•0ÿãÄ‹ k=¸¸¨@_0@, ˆ (h T׋ª ãñøü~?ƒŒ€Ù1.ýE_*9pÐrH‡AUnX«ÃJ{zâU ª<0…1†f15”0ÿãÄŽ ^¼øÙžœn
x0€Ó0<À•0@_0@, ˆ (h T×‹Õ  Ï Áž‚>B
À|€ ( _ádb´
€ÿãÄH È6@
_  ?ù. ¯Š_ÿÊCT@1V9¡ëÿ»;²vxí\È 0˜ƒ?ÿü18lcÀ¸Ãß „\Nd ÷ÿÿÿãÄW!ƒŠ|a–˜øã€Äkð[DôP@ €Pÿÿþ'á l-ìsã&\Y] öÿÿÿÿôËl_M6 H•¬Zq{ ÿãÄº¶øÉ�h šÛý7gÿvt—ÿô–¥&\#£ò!ò¢ÝKV«·ÿÿݙٖ‰‘ïþ*ñp9‡T¯üVÿø¼ ð ÿãÄJþá“P 'pÑÁbšªA”…_€Æ áà? n«ù#H§ÿÿž2;ÿÿÿÿÿÿïg@™ÿV"ÿñ {þ ¡q�RéÿãÄ ¶ô
’P :¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ U Và0ÂT ÿãÄ "‚ñA“h
p*üÍÿ'4ÿÙÙù�EKZ•/ÿþµ/]Ÿÿÿâ¥�ÙÒEI‡oþ¡[ÿã rµC�h�r}ÿãÄ¢ºð
“h J$UåôÖ›£û¦ôtO{þêjïò!ÿ³©¿ÿÿÿ¡¡M3úœM?ÿ% ÿáå ò[’ÿãÄ ’ �“8 )ºbI/ý_�!�P±°Á`€ xD“ÿÿùBÿ”;ÿÿÿÿÿÿñþ‚0wÿÕ ¶Àm ÊÀÉÿãÄ*N®YÕ
P´’(("³šµÿÿI&ROÒI”“õ%R_ÿ·ÿÿÿþ¥þRÕ¼¥©}KRÿy@Y
1…2<0…1†f1ÿãÄ È6@
_ 5”0n
x0€Ó0<À•0@_0@, ˆ (h T׋Õ"81À´0.pxGøÌ„SüÑÌ ?ÿãÄ’ÊÈ
•P
ü�»ÿ�Éãð»à&ÿÿö“¹9îyçÿÿÿ±ç’)ãÆ<¢ßÿÿÿ�A¼¸ü�ÃÕrš¢‰tºÿãÄ Jä
Íh
]E$ŸZ(¢’I}jI/ÿÿÿÿô…Aäl’Oÿÿÿÿÿÿõ£ú(˜—IÐ^*
G .˜ÿÿ_ÿýmÿÿãÄ ŠF%ø¸/$ÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU ðð
»HaQÿÿM7ÿ¡ÿÿÿþ¢ $SÿÿÿÿÿãÄ"ºRËS  ÿÿÿú“s
H à€µAÌ* í³äø-`�™bî_tÓQ4bÞ;Ñ dL:!ŠTk{] YQýÿãÄ*rŠáA”h `SQEJ215ÿ ÔÕj(è©×ÿÔϧ—Ò
P’KI'HÉ%à&ßþBã ‡üÄÄ»ÆÌ\JÉ‘äÿãÄØ6L ß -™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý 0‰^
žÿ­ÿÿ×ÿãÄ k=¸¸¨õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿÿãÄ# k=¸¸¨ø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©ÿãÄ8 k=¸¸¨oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º ÿãÄM k=¸¸¨0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿãÄb k=¸¸¨ÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^ÿãÄw k=¸¸¨
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º<0…1†f15”0n
x0€Ó0<À•0ÿãÄŒ k=¸¸¨@_0@, ˆ (h T×‹Õ �Ààp89ÀšEÆDÍD Æ*òùºÍÝÇx…Å.¤kGñ)�¤ÿãÄ¡ k=¸¸¨Nå!pVÖÿ‹xÆ Psƒ.ز‹‹ãpo¯ÿ Ó�ÀO¡#`Óõjÿñ” ‰‹ – â�A’Ii:Eãe ± dÿøT?åÒé;ÛÿÿõÕ D[" ÐÿãÄŠ ŠÂÚ�›ˆ *
‘„á :1iôæ‹ ­É² ö¹-’ÄOýÞäñ:V"ÄÉ—ûÝÑ77bh²P,0È�G ¿úo¾ùxšÿãÄBÚÊÈ
•� ,˜/—7.õ}ªA¨-š¤ñ©"ÄȳDô-Ÿÿ»_ÿ 8¤0ÈÌÀFp ÿÿÅŠ à �ÀÿãÄ ò»YŠ˜ œQÀ°xcÿ˜Öÿ$�ÿÿð¼óüáÿÌ’ÿÿÿÿ«VªA*òSþê#
íoÿ%¿þUN}¦KsƒÿãÄ ªJè
“8 ðA/Í©/jš�ïŸÿOóóÏT ÿà@ÿãĺN¶YÕ
˜ @ÆApãKƒ4lèÿÿÒI”“ô’e$ýIT—ÿíÿÿÿÿ©”µo)j_RÔ¿ÞP@ÀLaGM<0…1ÿãÄ È6@
_ †f15”0n
x0€Ó0<À•0@_0@, ˆ (h T׋ª ’I Ê\K‚¨ T ŸäPÑçùÿãÄòÂÔÉ”P
£˜ù:?vÿÿŸˆ±lÉ¿ÿý‡çÏ=Ï=ÿÿÿ繊xñ�ÂQoÿÿÿÇ¡~\~<>ÒDz¤¸jÿãÄ:¶ì
�h Ýf)?ú)$¿õ%ROÿõ%�ƒr_‡_ÆaÖúZµÿúÚ´kE“DÃÿ†�þ"IðÕÿðÕ ( ÿãÄÂJò
“h
a*P8`Ès4Oü‚‰r!þŠLŠKÿôTµ IRÿÿ­K×gÿÿû;³¤Š’1ßý_þ0§+dƒ›¢2ÿãÄ‚¶ô
‘P dT1:i­:?Óz:üýíÿî�0Ámþ# …6ÿÿÿíµÌ#'ÿ£†ü�ÿÂüR.郸MÿãÄÂFð
“h eƒ!Óu¦£$[ߤ‹+ûkF´¶‚áKZ:H£ÿoþ½zÿÿßMÃâµ%RO2WÿŠÇ>TC`lI(Sÿãĺ¶ð
“h :*ù‚i¡þ›³ÿîÎ’ÿþô–¥&\#£ò!ÿÔµj»ÿÿvgdRZ&G¿ø©ÿøs©_ø¬
ÞBêJÿãÄ N¼Ô 
ªKÿÿÿÿÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•aU0
—Lÿ¯ÿÿoÿÿÿÿãÄ *F$¸/&ü#
p0´ßÿ³±}����ÙÙøEQ gyŸéÿB ˆ„ Æ8‘Œiíå)”¦ßòœ<
A̪GD‚ÿãÄÒJë Ãc"Y=H‰>I N˜“#šd™
&�ˆoþ™»&ÿãÄU"jú¸
›  ûä8ƒHpç�á["h¤UGÿS©ªA”hy#AZˆJ%Ž‘T“1IÑU_ÿt7ßú*YŠM6 Ù*ÿãÄŠ¶üÉ�P 3XÙÇN‚vÿMÙÿÝœåÿú*!ãÁI¿…?‹‡t_ÿÿÿ{<Ó”Ò"ßüððÿ¿þU ð ÿãÄ"Ká“8 ,ᣆdÕPºÝ¡Wà5 5`ÂÿÆŒy?ÿýGŽÿÿÿÿÿÿÿt?öÿðÉïù ¡q�Ré:ÿãÄ ¶ô
’P ¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ * «pa*PÿãÄ ²‚ñá“h
8~f‚ ÿ�BÑ.D?övE_þD#ÑRÖ�%Kÿÿ­K×gÿÿø©gvt‘RF!Ûÿ¨VÿøÂœ®Ì\JÉ‘ÿãÄà6L ß ä-™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ �ÿÿÿÿÿÿÿÿÿþŠ<0…1†f15”0ÿãÄ È6@
_ n
x0€Ó0<À•0@_0@, ˆ (h T׋Õ8àÇÆ€eƒŠ`å‘¿´˜"éš—Ïž7ÿócWÿãÄ‚ÂÜ
”h
6E/þ÷y‘Ó…ñ,Íÿý$–¥&ƒ:ÿÿÙ�‘I‹¦F$ˆü@ÿÿÿð…f py0.…ÃD4AÿãÄ òNä
Ñ€
 ‚³ÿÿÿõ­Ý!|G!ÿÿÿÿÿÿÿ ‚}H´ �D<=­G×%ý¥ÇU©©iq^32©{32ÿãÄ’VÔ ÐÔ=ÿ™¿ŒÍÿ³ü?ûýT FffÿÿÿÿÿúšÞ¦škji¦šld a`‡ÄÇ?U 0‰^
žÿ­ÿÿãÄ k=¸¸¨ÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpÿãÄ! k=¸¸¨gÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿãÄ6 k=¸¸¨ÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„ÿãÄK k=¸¸¨º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿÿãÄ` k=¸¸¨ôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0ÿãÄu k=¸¸¨‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º<0…1†f15”0n
x0€Ó0<À•ÿãÄŠ k=¸¸¨0@_0@, ˆ (h T×‹Õ  Ï Áž‚>B
À|€ ( _ádb´
€ ?ù. ¯Š_ÿÿãÄŸ k=¸¸¨ÊCT@1V9¡ëÿ»;²vxí\È 0˜ƒ?ÿü18lcÀ¸Ãß „\Nd ÷ÿÿøã€Äkð[DÿãÄ´ k=¸¸¨ôP@ €Pÿÿþ'á l-ìsã&\Y] öÿÿÿÿôËl_< h^G)ã"󭨣I*)V�Ij×ÿÿãÄÉ È6@
_ ÿÿÿú(�²_ÿÿÿÿÿÿÿ­©%1 …"Cq
G .˜ÿÿ_ÿ©jZ–ßÿÿÿøFàai¿Ô¥©jZ–7ÿãÄØ!ƒŠ|a–˜ÿdRZ—Â*ˆ;ÌÿOú a‚ ‚ßÿÿÿÿÿÿÿé̘ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r ÿãÄ�JðÉÍh
H0% „ê  Ȭg>nÆ ©φÐg-å†íé­³ˆÃ÷ÝeÿÝq²œ¯MeúÙ¬DH‘TŠ“F*ÿãĘF%ø¸/$«SY’92X#ÉQÌ~@ƒ Ûm—I’ÁLép›L¨Oÿ×÷u¦è„Ò*•Éât¬Eˆ 4,်MÿãÄ¢ R¼T 
zõ¤‰H™íÿ�€/yD¸_Z ÐN£$Îþ.# (‚Š(“€ÓQe‘3PåqŠ^O›¬ÝÌkò¹ÿãĨ"‚ºÅA›  "jF´ çË„LÈœ¢�ù\˜'Ø3 زxÄÔÉ�``süœ+“á±pÐáq¿V—ÿ— EÈÿãÄY"BÂå‘” !‰
=‡O2/(¼^2/9€��ÿÁ» 8 ‹†ŠA”ƒPTFDÉò¿÷ê ä'MÝ0ÓÿãÄr
á“8‹ßOÒ_À�È(XØ`°
À <¢ IÿÿüL3ôý¿ÿÿÿÿà§üø)ÿœ#?þ9ø–sƒ8ö ¦�ÿãÄBºè
“P
‚cþ\/¦iþnìÿþq®q©ÿûÎTCÄ@tßÿÿC•L¹ŸÿÿììiÌiÆ�Œ†Ÿÿÿþ
¤*=
Œ¢=ÿãÄRRÀÉÔ 
8^6Z,¥­ëF´}híëGýÿÿê2"Á @ÂÉÿÿÿÿÿÿÿþ¶Z’&ˆ¸_À i:Ãj
G .˜ÿãÄ ŠF%ø¸/$ÿÿ_ÿýmÿÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU 8»µ  R�¢ é§R ¨sÈ9ºÂá8\&ÿãÄ‚RÓR˜ <ƒ—ÔL
Ì"‡�dÓ0 ˜A(7R¿ÿè
²/ÿÿÿÿÿÿÿMéôꀷ úCF 0 a*ÿãÄÚJò
“h
P8`Ès4Oü\± ;?ÑI‘IþŠ–´ *_ÿõ©zìÿÿÿgvt‘RF!Ûÿ«ÿÆåjdƒ›¢2ÿãÄ‚¶ô
‘P dT1:i­:?Óz:üýíÿî�0Ámþ# …6ÿÿÿíµÌ#'ÿ£†ü�ÿÂüR.郸MÿãÄÂFð
“h eƒ!Óu¦£$[ߤ‹+ûkF´¶‚áKZ:H£ÿoþ½zÿÿßMÃâµ%RO2WÿŠÇ>TÌ\JÉ‘ä-ÿãÄØ6L ß ™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý<0…1†f15”0n
ÿãÄ È6@
_ x0€Ó0<À•0@_0@, ˆ (h T׋ª$àé˜x¸
Ô¼¸È ²e'ö Æ)$¿ßOI*ÿãÄâÂä
”h
’ôÞ™šd»ÒIq`Fßý7¦þõ%¤º¿ÿ¶†\E5¢¥£Z(¬‘Çÿè—Ý7ÿƒ!‘·* ÌÀ
À ªÿãÄ ºNßÐ� D[ÿû¢‹^‰«¢‹tQu¢Ýÿÿõ$"C¸Ûÿÿÿÿÿÿÿú&(RLr
q ­
G .˜ÿÿ_ÿýmÿÿÿÿÿãÄ ŠF%ø¸/$„`.›ÿþ7ÿÿ„Uw™þŸô* ÝÔ
SLÃÿÞ÷½ï¿ÎrvNÉØõ�Xðo™n˜Îq¾ðÿãÄ%2Nç
Oh
3‚¬$bæ. èzs�q7»Ò”×ÿ7ÿýá’ÿÿÿÿÿÿÿM4ú€€ ¸\@Ö¹‘.àÅÿãÄ¢Rà¡”hÏADÑ‹~Òh™59þŠ,Š(ÿýT£#_þ÷{QGEN¿ÿÿI%¤“¤d’‡poÿÿóï< h^G)ÿãÄJðÉÍh
ã"󭨣I*)V�Ij×ÿÿÿÿú(�²_ÿÿÿÿÿÿÿ­©%1 …"Cq
p
À Ê9¿ÿ×ÿêZ–¥žÿÿãÄZF*8¸/$ÿÿÿÂ. éþ¥-KRÔ±ùÿ²)-KáŸ
š?§ý a‚ ‚ßÿÿÿÿÿÿÿé̘ ØÄÝ?ÿãÄ R¼T 
ÿÿÿÿÿÿúu#Ããr€r H0% „ê 0
0Ešà€}�à s–ü¾\@ßüå`ª@­°<ÿãÄ!R‚ê‘”h ª¿E&E%ÿñpu¢¥­
íKÿÿZ*ZÔ�“ÿÿøD;:HºH¤dMÿPFÿøŒœŠû?ÿÅjC�h�rÿãÄ¢ºð
“h }J$UåôÖ›£û¦ôtO{þêjïò!ÿ³©¿ÿÿÿ¡¡M3úœM?ÿ% ÿáå ÿð
ÿãÄ NÓÓ˜
€ \¢áj_ÿþ´kGÖ�hÿÿÿþ‘x&
b'ŸÿÿÿÿÿÿÿôLM27�ä\'²
G .˜ÿÿ_ÿýmÿãÄ ŠF%ø¸/$ÿÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU þB%ä1F%–;¬ 8� "z""]ëº'ÿãÄ!RFÔÀÀæ9û»—õÝÏêi¦œ2aðN Úi¦Þ´ÿÿÿOôÓAÓ}H ‚iº�.( !áãÕ ?ø õÅ–ÒãÿãÄ JJê@ÁŽÏU3?ÿU3?Ð"ŽQ"@ ¢Sè‘"D‰ÿÿÔÔ5¿ÿÿÿÿÿÿÿši­(Œ*<0…1†f15ÿãÄ È6@
_ ”0n
x0€Ó0<À•0@_0@, ˆ (h T×‹Õ ƒ<7xn ð’h\ÙþO“…Cô7ÿ÷RÿãÄÚÂ| –Pru'ÿÿš?ƒX+$ÿÿñø݉ÉØ÷ÿÿÿèÌ„…ˆ…�NŸÿÿþ<4œn ¿ÿÿæÄêdƒ›¢2dTÿãÄ ‚¶ô
‘P 1:i­:?Óz:üýíÿî�0Ámþ# …6ÿÿÿíµÌ#'ÿ£†ü�ÿÂü
ÞBêJªKÿÿãÄ N¼Ô 
ÿÿÿÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•aU a‚ ‚ßÿÿÿÿÿÿÿÿãÄ R¼T 
é̘ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r H0% „ê iÂÌÁ8l Ĉ™/ˆŠA’üÿãĪºíá“h ˆ Ð\KKô…ÿøÌ:ÙiÓ‹Íÿÿ»-éïÿÿøh[ÓÓRæ àþÕ±$¿þÓtÙ?ù‘µW ¡q�ÿãÄê¶ô
’P
Ré:¯A¨-Ÿýjuÿú�ÿ~{“󱀜wÿÿþŸÿÿlËûf´„/?ÿŸÿá R ÌÀ
À ªD[ÿûÿãÄ ºNßÐ� ¢‹^‰«¢‹tQu¢Ýÿÿõ$"C¸Ûÿÿÿÿÿÿÿú&(RLr
q ­
G .˜ÿÿ_ÿýmÿÿÿÿ„`.ÿãÄ ŠF%ø¸/$›ÿþ7ÿÿ„Uw™þŸô* îä +N¯Oo?üóÏ<óïû]ê�S¦:c™ÆZöEki~[2ÉÿãÄ)ÊNç Xh
–l¶è¦Š ×)YZ�¢º
óÃ9ÿûÏÿô0†Hÿÿÿÿÿÿú ¦šo@� ˆ U¬!s"]ÿãÄzRà
”h
Á‹º‰£ÿ21E_è¢È¢�ÿÑEJ215ÿÿj(è©×ÿÿé$´’tŒ’Pîmÿÿþbb]âÌ\JÉ‘ä-™ÿãÄ Ø6L ß „¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý*Š ?œ.ÀÄ€ð
HÿãÄ¡&xQV@
ÂÑÆ8vStÿÿÿÿÓ[Üô÷}Î!Wxø \ø&¿ÿùG(àB‰%Áõ ¡q�Ré:ÿãÄ ¶ô
’P ¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ *
ÞBêJªKÿÿãÄ N¼Ô 
ÿÿÿÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•aU a‚ ‚ßÿÿÿÿÿÿÿÿãÄ R¼T 
é̘ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r H0% „ê â«Š)tÁøMeún´Ôd‹yÿãÄÂ~ñá’h D›'Å$,ÑÂ>¿í­ÑüˆG¶‚áKZ:H£ÿÛÿ¯^¿þ*~ún©*’y�r…oÿŠÇ>T[ƒ-°ÿãÄb¾ì
“P
|gÌé¡þ›³ÿû³œjþó•ñ›ÿÿèr¢)—oÿÿövgcNR"ßÿÿþRš=
Œ¢=8ÿãÄRRÀÉÔ 
^6Z,¥­ëF´}híëGýÿÿê2"Á @ÂÉÿÿÿÿÿÿÿþ¶Z’&ˆ¸_À i:Ãj
G .˜ÿÿãÄ ŠF%ø¸/$ÿ_ÿýmÿÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU :ÌÅ  L oM:�ñA‹Œ®`E Âp¸EÿãÄZN×Q˜ lsÉõAÌÂxÁ“LÀ€�pPn¤ÿýDÀgò/ÿÿÿÿÿÿÿMéôê
�
ä"†Š %ƒ\†�Ó[ÿãÄ ‚Nä
”h $åòâÿæŒ}ôRdR_ÿ¢¥­
ÅKÿýTµ �“ÿÿ÷gII‹ÄÐ5õø]N‹êÌ\JÉ‘ÿãÄØ6L ß ä-™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý<0…1†f15”0ÿãÄ  6@
_ n
x0€Ó0<À•0@_0@, ˆ (h T׋í
$’ ÄÏ`*5yD;í.Ó4ÿ/Ÿ`\4:_H¾ÿãÄ2R¿T 
nåÂ(E¡¡˜æCI� B!ÿÿý9€³

á;›§ÿÿÿÿÿÿÿúËîP@ ¦ D� ð ÿãÄ"Ká“8 ,ᣆdÕPºÝ¡Wà5 5`ÂÿÆŒy?ÿýGŽÿÿÿÿÿÿÿt?öÿðÉïùÌ\JÉ‘ä-ÿãÄØ6L ß ™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý <0…1†f15”0n
ÿãÄ È6@
_ x0€Ó0<À•0@_0@, ˆ (h T׋Õ
$’ Îp&‘q‘3Q qŠ¼¾n³wG÷3N�hþ› ÿãĪ¾èÉ“h š�­­ÿtH¸hô¾.ëÿÐttHV¯ÿA¨2f‹74'�=^•N?ÿPÑÐoð]5R ÿð
ÿãÄ NÓÓ˜
€ \¢áj_ÿþ´kGÖ�hÿÿÿþ‘x&
b'ŸÿÿÿÿÿÿÿôLM27�ä\'²
G .˜ÿÿ_ÿýmÿãÄ ŠF%ø¸/$ÿÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU I! AȆ+<‰MúR”¦¼‡!8'àÐPM 8rÿãÄ!ŠJæAOh‚ÉWêô1C‘2ÆŸ½)¯ýïÿZi¼G ßÿÿÿÿÿÿêAßRÁÀÀqÃǪ}¦KsƒðÿãÄ ªJè
“8 A/Í©/jš�ïŸÿOóóÏTÌ\JÉ‘äÿãÄØ6L ß -™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý <0…1†f15”0nÿãÄ È6@
_
x0€Ó0<À•0@_0@, ˆ (h T׋Õ$àé˜x¸
Ô¼¸È ²e'ö Æ)$¿ßOIÿãÄâÂä
”h
*’ôÞ™šd»ÒIq`Fßý7¦þõ%¤º¿ÿ¶†\E5¢¥£Z(¬‘Çÿè—Ý7ÿƒ!‘·%\Un0•(ÿãÄBºð
‘h
ÿ3AÿÐgoÿgdUù�ù�EKZ•/ÿÿ­K×gÿâ§ÿ,îÎ’*HÄ; ßÿ¿þ0§+å°g8ÿãÄš¾è
“8
H¸È™¯ù|Ýfÿîšÿ=ØùŸÿî†a vwÿÿ˜èÓÿôÿóeÌSȉiÿÿÿÁÀÐÄŠT¨9ÃœÿãÄ’RÔ
Ò˜
A�–Š)$’Z(¢“õ¢Š)zÑEÿÿÿô’/¸d‹ÏGÿÿÿÿÿÿÔ—ÒI$žQ *‘™'K¢ª
G .ÿãÄ ŠF%ø¸/$˜ÿÿ_ÿýmÿÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU \ÿð  š9A§ý¼sÈ;˜:_H›ÿãÄRRÃT 
/¤`LBpÐÌŠˆL æŸÿÿ×0@H°¸ŒMÓÿÿÿÿÿÿÿýeù€~€ `. YA Õ ð ÿãÄJþá“P 'pÑÁbšªA”…_€Æ áà? n«ù#H§ÿÿž2;ÿÿÿÿÿÿïg@™ÿV"ÿñ {þÌ\JÉ‘ÿãÄØ6L ß ä-™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý <0…1†f15”0ÿãÄ È6@
_ n
x0€Ó0<À•0@_0@, ˆ (h T׋Õs�4‹Œ‰šˆ ;ŒUåóu›º?ºiÑ­ÓvN…ÿãÄ¢¾è
“h moû©�4é|\×ÿ êj¤?«Wÿ Ô.‚Ó43%õzU8tÿürt?àºj¥ ÿð
€ \¢ájÿãÄ NÓÓ˜
_ÿþ´kGÖ�hÿÿÿþ‘x&
b'ŸÿÿÿÿÿÿÿôLM27�ä\'²
G .˜ÿÿ_ÿýmÿÿÿÿ„`ÿãÄ ŠF%ø¸/$.›ÿþ7ÿÿ„Uw™þŸô*ý ÈD¢†!À BÐ@�ŽÄ

Ë0�G» @„G»¸ŒÿãÄ'"FÕ€Á¦ýîíºÓM7Öši§˜|ˆ6ši·­?ÿÿÓý4ßÐA4ßR šn¤„ÀÊÃHxxú
ü 7•rþÆlÿãÄ NÝ€ÈÎò0eU_feRö«Æff.337ÿÿúšj Z‡ÿÿÿÿÿú›óM4Ób`âCj<0…1†f15ÿãÄ È6@
_ ”0n
x0€Ó0<À•0@_0@, ˆ (h T×‹Õ ƒ<7xn ð’h\ÙþO“…Cô7ÿ÷RÿãÄÚÂ| –Pru'ÿÿš?ƒX+$ÿÿñø݉ÉØ÷ÿÿÿèÌ„…ˆ…�NŸÿÿþ<4œn ¿ÿÿæÄêdƒ›¢2dTÿãÄ ‚¶ô
‘P 1:i­:?Óz:üýíÿî�0Ámþ# …6ÿÿÿíµÌ#'ÿ£†ü�ÿÂü )tÁÜ&ˆ²ÿãÄ zFð¡“hÁ�éºÓQ’-ïMÌŒQWöÖ�hÿm–´t‘Gþßýzõÿÿ¾›‡ÅjJ¤žd¯ÿŽ|¨+C`lI(Sÿãĺ¶ð
“h :*ù‚i¡þ›³ÿîÎ’ÿþô–¥&\#£ò!ÿÔµj»ÿÿvgdRZ&G¿ø©ÿøs©_ø¬ ‰ÿãĪ‚þ�“P Àœ4pX¦ªú¤*ü0
ùu_þßÿüñ‘ßÿÿÿÿÿøyûÙÐ&ÕˆƒïÿˆSßðí?N;38ÿãÄ¸.hÉÞ‚;0âÓ
0W€À*\à i°Ó^wñ�TxEÿÿÿÿÿÿX*X8 $<0…1†f15”0n
ÿãÄ È6@
_ x0€Ó0<À•0@_0@, ˆ (h T׋ÕRàÊ\ Â…ÍŠ\�ÿò|éÿ7/›ÿü¾è¨ÓÿÿãÄ‚ÂÔ
”h üÜÀÑ"@”y·ÿÿš@Ñ$R ÿÿþ‚ã&\Y|xq+ÿÿÿð[!(�`§ÿÿèé¡ Äñ²ÑÿãÄzVØÉÑ� E$’KZ(¤—Z(¢—¢Š(úÑEÿÿõ$d0î6ÿÿÿÿÿ¥ÿêI'ô’I'”F`ÑÍ.š¢
G .˜ÿÿãÄ ŠF%ø¸/$ÿ_ÿýmÿÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU \ïð  Â9@Ñi¿Ô‡Œ¹>`\4:_H¾ÿãÄ2R¿T 
nåÂ(E¡¡˜æCI� B!ÿÿý9€³

á;›§ÿÿÿÿÿÿÿúËîP@ ¦ D� ð ÿãÄ"Ká“8 ,ᣆdÕPºÝ¡Wà5 5`ÂÿÆŒy?ÿýGŽÿÿÿÿÿÿÿt?öÿðÉïù ¡q�Ré:ÿãÄ ¶ô
’P ¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ *
ÞBêJªKÿÿãÄ N¼Ô 
ÿÿÿÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•aU a‚ ‚ßÿÿÿÿÿÿÿÿãÄ R¼T 
é̘ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r H0% „ê â«Š)tÁøMeún´Ôd‹yÿãÄÂ~ñá’h D›'Å$,ÑÂ>¿í­ÑüˆG¶‚áKZ:H£ÿÛÿ¯^¿þ*~ún©*’y�r…oÿŠÇ>T[ƒ-°ÿãÄb¾ì
“P
|gÌé¡þ›³ÿû³œjþó•ñ›ÿÿèr¢)—oÿÿövgcNR"ßÿÿþRš=
Œ¢=8ÿãÄRRÀÉÔ 
^6Z,¥­ëF´}híëGýÿÿê2"Á @ÂÉÿÿÿÿÿÿÿþ¶Z’&ˆ¸_À i:Ãj
G .˜ÿÿãÄ ŠF%ø¸/$ÿ_ÿýmÿÿÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU :ÌÅ  L oM:�ñA‹Œ®`E Âp¸EÿãÄZN×Q˜ lsÉõAÌÂxÁ“LÀ€�pPn¤ÿýDÀgò/ÿÿÿÿÿÿÿMéôê
�
ä"†Š %ƒ\†�Ó[ÿãÄ ‚Nä
”h $åòâÿæŒ}ôRdR_ÿ¢¥­
ÅKÿýTµ �“ÿÿ÷gII‹ÄÐ5õø]N‹êÌ\JÉ‘ÿãÄØ6L ß ä-™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý<0…1†f15”0ÿãÄ  6@
_ n
x0€Ó0<À•0@_0@, ˆ (h T׋í
$’ ÄÏ`*5yD;í.Ó4ÿ/ŸÆçÑëÿÿ¯ÿórÙÿãĶ È6@
_ ‰>M6 M"ã"f¢ ã·/›¬ÝÑýÌÍèÖ�—Ýu![[ùº‰ Á›-”µ�š£ñ¸7æ‡ÐAÿãÄÅ"ûŠL —˜$R úµè!4dÍnNñÇRT’RNdl£ÿˆ ²!£ Ô?i:¥Õþ"Õ ™
â¬N~@Ê—ÿãÄtZ¶èÉ“ˆuR”¿ÿ·�=ÈjS{ÿü8[ò[²ý˜4¨É�ÿôæ�1. b]GóD&„ÀuüË1.¤‘4L“¿îÿãÄIrŠÖ�š� h…H2+DÅSœÇÿ©“S»s`‚Œ’Y‘yÌ‹ÆÉP6÷ÿ…@Š27ùt™'bV7ÿÿ­Ì\JÉ‘ÿãÄØ6L ß ä-™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý <0…1†f15”0ÿãÄ È6@
_ n
x0€Ó0<À•0@_0@, ˆ (h T׋Õ$àé˜x¸
Ô¼¸È ²e'ö Æ)$¿ßOÿãÄâÂä
”h
I*’ôÞ™šd»ÒIq`Fßý7¦þõ%¤º¿ÿ¶†\E5¢¥£Z(¬‘Çÿè—Ý7ÿƒ!‘·% ÌÀ
ÀÿãÄºNßÐ� ªD[ÿû¢‹^‰«¢‹tQu¢Ýÿÿõ$"C¸Ûÿÿÿÿÿÿÿú&(RLr
q ¬
G .˜ÿÿ_ÿýmÿÿÿãÄ ŠF%ø¸/$ÿÿ„`.›ÿþ7ÿÿ„Uw™þŸôU ÝÔ
SLÃÿÞ÷½ï¿ÎrvNÉØõ�Xðo™n˜Îq¾ÿãÄ#2Nç
Oh
ð3‚¬$bæ. èzs�q7»Ò”×ÿ7ÿýá’ÿÿÿÿÿÿÿM4ú€€ ¸\@

k\ȃÿãÄ zRáA”h
pbî¢hÅ¿Èq 'Kè¢È¢�ÿÑEJ215ÿÿj(è©×ÿÿé$´’tŒ’Pîmÿÿþbb]âÌ\JÉ‘ÿãÄØ6L ß ä-™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿý 0‰^
žÿ­ÿÿÿãÄ k=¸¸¨×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿãÄ" k=¸¸¨ÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿÿãÄ7 k=¸¸¨©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„ºÿãÄL k=¸¸¨ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿãÄa k=¸¸¨ÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½<0…ÿãÄv k=¸¸¨1†f15”0n
x0€Ó0<À•0@_0@, ˆ (h T׋ª$8àÉ8†€€h @` ÿãÄ‹ k=¸¸¨
À&€À àÜÀD ‚ã˜H¸ïÿñ“b?ÆçÑëÿÿ¯ÿórÿãĵ È6@
_ Ù‰?M6 M"ã"f¢ ã·/›¬ÝÑýÌÍèÖ�—Ýu![[ùº‰ Á›-”µ�š£ñ¸7æ‡ÐÿãÄÄ"ûŠL —˜A$R úµè!4dÍnNñÇRT’RNdl£ÿˆ ²!£ Ô?i:¥Õþ"Ê
ÞBêJªKÿÿÿÿÿãÄsZ¶èÉ“ˆÿÿÿúFD!8ô8ž�ÿÿÿÿÿÿú�I“#’8!ÄL,`P…Ô•aU a‚ ‚ßÿÿÿÿÿÿÿéÌÿãÄH N¼Ô 
˜ ØÄÝ?ÿÿÿÿÿÿúu#Ããr€r H0% „ê °ïÿ2`$`‘`vj°Äªÿÿ¹JÿãÄN R¼T 
ÅéV:ÿÿ9"£¢à=ÇâQyWåMùpòdâÍÔ’JIþ ÊÍËè‘pÔ…œj¤‘RÚ—þnxÌÝúk7wÿãÄT!úºÒ�›˜ S­TkGÿ„`fo/ºúDá BTQZ(¬ÕŠ%Q!ÿð$Ñ›'ÍKé­7øå �ßÿ'Cƒ¸E
ÿãÄê¶ð
“h
%&Hª½R1Iýº):ÿï©*’ÿ¾šno©,|’ÿïÿÕ«WÿþÚëÖ�h´Äa?ÿ§ÿâ€RœbnaÿãÄ*ºô
�P
*`sý4Ÿúíÿììj~# …5ESÓ¿ÿþ©ÿÿ‚/þ­vœjB�/ÿ‚_ÿ)]å°g8H¸ÿãÄš¾è
“8
È™¯ù|Ýfÿîšÿ=ØùŸÿî†a vwÿÿ˜èÓÿôÿóeÌSȉiÿÿÿÁÀÐÄŠ ÀÀ0 ÿãÄ · ‘…€l3‚žÿÿþyßÿÿ[*¡NkùÃÿœÿÿÿõ%I%$æFÁŽòÇÿ,éUZ¿Ë_ÿ-U 
k\ȃÿãÄ zRáA”h
pbî¢hÅ¿Èq 'Kè¢È¢�ÿÑEJ215ÿÿj(è©×ÿÿé$´’tŒ’Pîmÿÿþbb]âÌ\JÉ‘äÿãÄØ6L ß -™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ þ?ÿÿÿÿÿÿÿÿÿýÚ- ÿ°0Ð,€Ä ÿãÄ¡&€yV 8€P€ °Õã¨�(MÿÿÿÿÓ[Üô÷}Î!Wxø \ø&¿ÿùG(àB‰%Áõ ¡q�RÿãÄ ¶ô
’P é:¡‰ÐjE'ÿZ�ú�ýùîOÎÆqß…?ÿôÿÿí™lÖ�…çÿSÿü 8ïþ * Và0ÂTÿãÄ"‚ñA“h
 p*üÍÿ'4ÿÙÙù�EKZ•/ÿþµ/]Ÿÿÿâ¥�ÙÒEI‡oþ¡[ÿã rºÌ\JÉ‘ÿãÄà6L ß ä-™„¸ù€°Q‚€¾ ` ³ Ø�€
S˜ �ÿÿÿÿÿÿÿÿÿþŠ 0‰^
žÿ­ÿÿÿãÄ k=¸¸¨×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿãÄ" k=¸¸¨ÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ 0‰^
žÿ­ÿÿ×õÿÿÿãÄ7 k=¸¸¨©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„½ÿãÄL k=¸¸¨ 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿÿ¯ÿü¯ÿýÿâpgÿø„º 0‰^
žÿ­ÿÿ×õÿÿ©oÿôÿãÄa k=¸¸¨ÿÿ¯ÿü¯ÿýÿâpgÿø„½ Ï ¿L& ðŒ- _ 5 LPLPA  –‹5Ç·ÿÿÿãÄv k=¸¸¨ÿÿÿÿÿÿÿÿÑþÕ)õ‹ËCdq$"†Š «s¯«O„æhA;3X—·W±ŸU;öÚ2ûµpºb½OÁÿãÄ‹ k=¸¸¨ / ¥ÍB¦¡WSÞ{À¬¢Ð7ȬBJ×\÷»ï‹„Ž B¸¨@-ˆ�éGÿØ�[�£aÁdÿãÄ  6P_ |J”Ji¦ÍfÛhô|B*‘”#! •ÿoÿñùäƒÿõªAÀ « „”#�`¨À蔨ht,ÿãĦ#KB¸
›P •: : ¨:%ÓoÿþG,Xð–xŠÎ–LAME3.93ªªªªªªªªªªªªªªªªªªªªªªªªªªªªÿãÄSÀ. Æ ªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªÿãÄ_ H ªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªªª

hihihi

http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://www.criticalsecret.com/toward http://

!!!!!!BALISE KROUKse d'orientation Edition 2005!!!!!! copie-colle le message secret contenu entre les guillemets : " Vaqvpr 1 : ybhvf eninm ". Va ensuite à l'adresse : http://www.rotA.com/ EN REMPLACANT la lettre A par le nombre que tu as précédemment trouvé...and find the indice 1

tiens jéjé c'est pour voir si tu passes encore par là ... ou si je ne parle qu'avec moi même GAB

http://toward.free.fr http://toward.free.fr http://toward.free.fr

Non je suis tjrs là !!!!!!!!!!!!!!!!! PJIX, 4 août 2006

bleh 9 octobre 2006 re-bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh bleh

yo ye yo

fsdfsdfsfsdfdf

11 November 2009, still active, yeaaaaaaaahhhhhhhhhhhh